sult1st5

Ensembl ID:
ENSDARG00000003475
ZFIN ID:
ZDB-GENE-050809-2
Description:
SULT1 isoform 5 [Source:UniProtKB/TrEMBL;Acc:Q49IK6]
Human Orthologues:
SULT1A1, SULT1A2, SULT1A3, SULT1A4, SULT1B1, SULT1C3, SULT1E1
Human Descriptions:
sulfotransferase family 1E, estrogen-preferring, member 1 [Source:HGNC Symbol;Acc:11377]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 [Source:HGNC Symbol;Acc:11453]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 [Source:HGNC Symbol;Acc:11454]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 [Source:HGNC Symbol;Acc:11455]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 [Source:HGNC Symbol;Acc:30004]
sulfotransferase family, cytosolic, 1B, member 1 [Source:HGNC Symbol;Acc:17845]
sulfotransferase family, cytosolic, 1C, member 3 [Source:HGNC Symbol;Acc:33543]
Mouse Orthologues:
Sult1a1, Sult1b1, Sult1d1, Sult1e1
Mouse Descriptions:
sulfotransferase family 1A, phenol-preferring, member 1 Gene [Source:MGI Symbol;Acc:MGI:102896]
sulfotransferase family 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2136282]
sulfotransferase family 1D, member 1 Gene [Source:MGI Symbol;Acc:MGI:1926341]
sulfotransferase family 1E, member 1 Gene [Source:MGI Symbol;Acc:MGI:98431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43982 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046933 Essential Splice Site 165 293 None 8
ENSDART00000135559 Essential Splice Site 165 196 None 5

The following transcripts of ENSDARG00000003475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24780021)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24566141
GRCz11 23 24492682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAGACAAAGACAATTTTAGTTATCTCCTAATATTTAAATTTTTTTTC[A/C]GTGGTATGGGGATCCTGGTTTGATCATGTGAAAGGATACTGGAGGGAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link