zgc:92458

Ensembl ID:
ENSDARG00000003391
ZFIN ID:
ZDB-GENE-040704-77
Description:
sorting nexin-7 [Source:RefSeq peptide;Acc:NP_001002229]
Human Orthologue:
SNX7
Human Description:
sorting nexin 7 [Source:HGNC Symbol;Acc:14971]
Mouse Orthologue:
Snx7
Mouse Description:
sorting nexin 7 Gene [Source:MGI Symbol;Acc:MGI:1923811]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16486 Nonsense Available for shipment Available now
sa37919 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045724 Nonsense 153 413 4 9
ENSDART00000123598 Nonsense 175 469 4 10
ENSDART00000132597   None 257 None 6
ENSDART00000145658 Nonsense 248 508 4 9
Genomic Location (Zv9):
Chromosome 24 (position 32599421)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 30261144
GRCz11 24 30267408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGATTTCATAGARACCAGAAGAARGGCTCTGCACAGGTTTCTTAAC[A/T]GAATAGCAGAACATCCCATTTTCTCCAGCACTGAAGACTTTAAGATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045724 Nonsense 288 413 6 9
ENSDART00000123598 Nonsense 310 469 6 10
ENSDART00000132597 Nonsense 98 257 2 6
ENSDART00000145658 Nonsense 383 508 6 9
Genomic Location (Zv9):
Chromosome 24 (position 32605778)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 30254787
GRCz11 24 30261051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCGACTGTCTGGACAGATGCTATAAGGAGACAGACGAGCAGGTCAAA[C/T]AGCTGAACGATCAGCTCAGTCCAGCTCTTCATGAGTACGTGCTCTGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Dental caries: Genome-wide association scan of dental caries in the permanent dentition. (View Study)
  • Proinsulin levels: Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link