si:dkeyp-35f12.3

Ensembl ID:
ENSDARG00000003317
ZFIN ID:
ZDB-GENE-090313-385
Mouse Orthologue:
2610034M16Rik
Mouse Description:
RIKEN cDNA 2610034M16 gene Gene [Source:MGI Symbol;Acc:MGI:1916489]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14906 Nonsense Available for shipment Available now
sa16032 Essential Splice Site Available for shipment Available now
sa45392 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1031 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa14906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Nonsense 214 1215 2 12
ENSDART00000132166   None 141 None 3
Genomic Location (Zv9):
Chromosome 10 (position 7622091)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5632056
GRCz11 10 5632360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAAATCCCCAAATCTACTCATGGAYTCAACATGGAGCACATTACCAA[C/T]AAAATGTMAGCTATAAGATTAGCATCGCAGAGCTAAATGSGGAGTCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Essential Splice Site 877 1215 4 12
ENSDART00000132166   None 141 None 3
Genomic Location (Zv9):
Chromosome 10 (position 7629854)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5639819
GRCz11 10 5640123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAACGACAGTCCACACTGCCTCAGAAGCTGTGCTYGACCAGCAGCWA[G/A]TGAGTCCTTAGCAGACYAATATAAAAATAWGCTAGAACTGACTATTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Essential Splice Site 1008 1215 7 12
ENSDART00000132166   None 141 None 3
Genomic Location (Zv9):
Chromosome 10 (position 7634249)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5643869
GRCz11 10 5644518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCGTGCTCAGACATGACTGCTGCCTCTACTACTACAGAAACAAGCGC[G/A]TATGTTCAGCTTCTTCTTCTCCATGTTTTTGTCTTGTTGGAACATCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1031
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Nonsense 1079 1215 10 12
ENSDART00000132166 Nonsense 5 141 1 3
Genomic Location (Zv9):
Chromosome 10 (position 7640546)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5650166
GRCz11 10 5650815
KASP Assay ID:
554-0935.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATACTCATCRTGTTAATGTTGGTGCTTGTCATGGCAGAATCACGTGTG[G/A]GTGGACGTCACTCGGCACAACTCAAATCTGCCCCCGCTGGCGGTCAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link