zgc:158667

Ensembl ID:
ENSDARG00000003311
ZFIN ID:
ZDB-GENE-070112-1952
Description:
pantothenate kinase 2, mitochondrial [Source:RefSeq peptide;Acc:NP_001074075]
Human Orthologues:
PANK2, PANK3
Human Descriptions:
pantothenate kinase 2 [Source:HGNC Symbol;Acc:15894]
pantothenate kinase 3 [Source:HGNC Symbol;Acc:19365]
Mouse Orthologues:
Pank2, Pank3
Mouse Descriptions:
pantothenate kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1921700]
pantothenate kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2387464]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42166 Nonsense Mutation detected in F1 DNA During 2018
sa6290 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079211   None 401 1 7
ENSDART00000133041 Nonsense 13 437 1 7

The following transcripts of ENSDARG00000003311 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 15169805)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15084838
GRCz11 13 15215830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAACGATATAATGGAGCTGAACGGCTTCCACTGTGAGGGCGAGGGATG[T/A]ACGGAGAAGCAGGAGGAAGAGTCGACGGCGCTCAAGCTGCCTCGGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079211 Nonsense 364 401 6 7
ENSDART00000133041 Nonsense 400 437 6 7

The following transcripts of ENSDARG00000003311 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 15177498)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15092531
GRCz11 13 15223523
KASP Assay ID:
554-4988.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGTTTTTGTTGGGAATTTTCTGAGGGTGAACACATTATCCATGAAGT[T/A]GCTCGCGTATGCTTTGGACTACTGGAGCAAAGGACAACTCAAAGCCCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link