stx16

Ensembl ID:
ENSDARG00000003307
ZFIN ID:
ZDB-GENE-060810-113
Human Orthologues:
RP11-261P9.5, STX16
Human Descriptions:
Syntaxin 16 isoform a variant [Source:UniProtKB/TrEMBL;Acc:Q59G13]
syntaxin 16 [Source:HGNC Symbol;Acc:11431]
Mouse Orthologue:
Stx16
Mouse Description:
syntaxin 16 Gene [Source:MGI Symbol;Acc:MGI:1923396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9414 Nonsense Available for shipment Available now
sa18854 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002693 Nonsense 276 324 8 9
ENSDART00000002693 Nonsense 276 324 8 9
Genomic Location (Zv9):
Chromosome 6 (position 49688575)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49738256
GRCz11 6 49736909
KASP Assay ID:
2259-8128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATTAAATCCAGGGTACAGTCCTTGACAGAATCGACTTCAATGTGGAA[C/T]AGTCTTGTGTGAAAACAGAGGAGGGACTCCAGCAGTTACAAAAGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002693 Nonsense 276 324 8 9
ENSDART00000002693 Nonsense 276 324 8 9
Genomic Location (Zv9):
Chromosome 6 (position 49688575)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49738256
GRCz11 6 49736909
KASP Assay ID:
2259-8128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTAAATCCAGGGTACAGTCCTTGACAGAATCGACTTCAATGTGGAA[C/T]AGTCTTGTGTGAAAACAGAGGAGGGACTCCAGCAGTTACAAAAGGTGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link