stc1

Ensembl ID:
ENSDARG00000003303
ZFIN ID:
ZDB-GENE-060825-79
Description:
stanniocalcin 1 [Source:RefSeq peptide;Acc:NP_001038922]
Human Orthologue:
STC1
Human Description:
stanniocalcin 1 [Source:HGNC Symbol;Acc:11373]
Mouse Orthologue:
Stc1
Mouse Description:
stanniocalcin 1 Gene [Source:MGI Symbol;Acc:MGI:109131]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14379 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025008 Nonsense 243 250 4 4
Genomic Location (Zv9):
Chromosome 8 (position 52472346)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50334218
GRCz11 8 50322864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACCAGCCAAATCTACGCAACAGAGATGCCTCCWAWCTCTTTGGCAAG[A/T]AACGAAGYATCGGTGACAGCTCTTAATTTCAGAGCAGTTCGAACTTTGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link