wdr12

Ensembl ID:
ENSDARG00000003287
ZFIN ID:
ZDB-GENE-030131-371
Description:
Ribosome biogenesis protein wdr12 [Source:UniProtKB/Swiss-Prot;Acc:Q6NX08]
Human Orthologue:
WDR12
Human Description:
WD repeat domain 12 [Source:HGNC Symbol;Acc:14098]
Mouse Orthologue:
Wdr12
Mouse Description:
WD repeat domain 12 Gene [Source:MGI Symbol;Acc:MGI:1927241]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44630 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012903 Essential Splice Site 329 422 10 13
Genomic Location (Zv9):
Chromosome 6 (position 8089872)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9401287
GRCz11 6 9636826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGGCAGCACTGACAGACATGTGCGTCTGTGGGACCCCAGATCTAAAGG[T/G]ACCAAAGATGCCACATAATGATTTCCTCTCAAACTAACAGCTATTACCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link