zfand2a

Ensembl ID:
ENSDARG00000003283
ZFIN IDs:
ZDB-GENE-040426-1596, ZDB-GENE-040426-1596
Description:
AN1-type zinc finger protein 2B [Source:RefSeq peptide;Acc:NP_956811]
Human Orthologue:
ZFAND2B
Human Description:
zinc finger, AN1-type domain 2B [Source:HGNC Symbol;Acc:25206]
Mouse Orthologue:
Zfand2b
Mouse Description:
zinc finger, AN1 type domain 2B Gene [Source:MGI Symbol;Acc:MGI:1916068]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa683 Nonsense Available for shipment Available now
sa2100 Essential Splice Site Available for shipment Available now
sa30840 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40144 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055155 Nonsense 123 282 4 9
ENSDART00000127680 Nonsense 123 282 5 10
Genomic Location (Zv9):
Chromosome 3 (position 43234957)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42674523
GRCz11 3 43380538
KASP Assay ID:
554-0591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGGAAATGATCCGGGTGACGTGTGACCAGTGCCACYTAAACTACTG[T/A]CTCAAACACAGGCATCCACTCGACCATGACTGTAAGACTGACAACAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055155 Essential Splice Site 145 282 4 9
ENSDART00000127680 Essential Splice Site 145 282 5 10
Genomic Location (Zv9):
Chromosome 3 (position 43234890)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42674590
GRCz11 3 43380605
KASP Assay ID:
554-2804.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCGACCATGACTGTAAGACTGACAACAAGCCGGTCTCCAAATCAGGG[T/C]AAGCCTGGTTTTCATGCGGAYCAGTGATGCTCTCWGGAGGAMTAGGGRTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055155 Essential Splice Site 186 282 5 9
ENSDART00000127680 Essential Splice Site 186 282 6 10
ENSDART00000055155 Essential Splice Site 186 282 5 9
ENSDART00000127680 Essential Splice Site 186 282 6 10
Genomic Location (Zv9):
Chromosome 3 (position 43234684)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42674796
GRCz11 3 43380811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACATGTCTAATGGAGTCACTGGAAACGCCAGACCTCAGAGCAGTAGG[T/G]AAGTACATTTTGGAAAACACAGTGTCCTCAGAAGTGTCAGTTCAATATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055155 Essential Splice Site 186 282 5 9
ENSDART00000127680 Essential Splice Site 186 282 6 10
ENSDART00000055155 Essential Splice Site 186 282 5 9
ENSDART00000127680 Essential Splice Site 186 282 6 10
Genomic Location (Zv9):
Chromosome 3 (position 43234684)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42674796
GRCz11 3 43380811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACATGTCTAATGGAGTCACTGGAAACGCCAGACCTCAGAGCAGTAGG[T/G]AAGTACATTTTGGAAAACACAGTGTCCTCAGAAGTGTCAGTTCAATATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link