
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
naa15a
- Ensembl ID:
- ENSDARG00000003213
- ZFIN ID:
- ZDB-GENE-030131-2392
- Description:
- N-alpha-acetyltransferase 15, NatA auxiliary subunit [Source:RefSeq peptide;Acc:NP_956940]
- Human Orthologue:
- NAA15
- Human Description:
- N(alpha)-acetyltransferase 15, NatA auxiliary subunit [Source:HGNC Symbol;Acc:30782]
- Mouse Orthologue:
- Naa15
- Mouse Description:
- N(alpha)-acetyltransferase 15, NatA auxiliary subunit Gene [Source:MGI Symbol;Acc:MGI:1922088]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11586 | Nonsense | Available for shipment | Available now |
sa15657 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11586
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017785 | Nonsense | 178 | 867 | 5 | 20 |
ENSDART00000124417 | Nonsense | 178 | 867 | 5 | 20 |
- Genomic Location (Zv9):
- Chromosome 14 (position 49064800)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 47142459 GRCz11 14 46129751 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAAGATTATGAGATGGCGGCTAAGATCGTGGAGGAGTTTCGCAAAACT[C/T]AACAGGTACRCTCAGTTAATGATTTTCAGACAGATRATAGRGCAGNNACCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15657
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017785 | Nonsense | 699 | 867 | 17 | 20 |
ENSDART00000124417 | Nonsense | 699 | 867 | 17 | 20 |
- Genomic Location (Zv9):
- Chromosome 14 (position 49083912)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 47161571 GRCz11 14 46148863 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGTTTGTAGAAAAGTATCTGCTGATGCTGCAGTCGGTGAAGAGAGCTTA[T/A]TCCCTGGACCCCGATCACCCGTGGCTCCACCAGTGTTTAGTGCGGTTCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: