zgc:101572

Ensembl ID:
ENSDARG00000003208
ZFIN ID:
ZDB-GENE-041114-119
Description:
Protein kinase-like protein SgK196 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3W1]
Human Orthologue:
AC113191.1
Human Description:
Protein kinase-like protein SgK196 [Source:UniProtKB/Swiss-Prot;Acc:Q9H5K3]
Mouse Orthologue:
4930444A02Rik
Mouse Description:
RIKEN cDNA 4930444A02 gene Gene [Source:MGI Symbol;Acc:MGI:1921903]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1372 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa1372
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006257 Nonsense 52 347 2 3
ENSDART00000122695 Nonsense 52 347 1 2
Genomic Location (Zv9):
Chromosome 13 (position 8916266)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9218886
GRCz11 13 9550909
KASP Assay ID:
554-1284.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACCTGGATGCCCTGTATCAGAACACAAACCCTCCGTCAGCACACACA[C/T]AATGTCCTCCTCGCCACTTTAAAGTGGGCACTATGAGCTCCTGCAGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link