Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101572
- Ensembl ID:
- ENSDARG00000003208
- ZFIN ID:
- ZDB-GENE-041114-119
- Description:
- Protein kinase-like protein SgK196 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3W1]
- Human Orthologue:
- AC113191.1
- Human Description:
- Protein kinase-like protein SgK196 [Source:UniProtKB/Swiss-Prot;Acc:Q9H5K3]
- Mouse Orthologue:
- 4930444A02Rik
- Mouse Description:
- RIKEN cDNA 4930444A02 gene Gene [Source:MGI Symbol;Acc:MGI:1921903]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa1372 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa1372
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000006257 | Nonsense | 52 | 347 | 2 | 3 |
| ENSDART00000122695 | Nonsense | 52 | 347 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 13 (position 8916266)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 9218886 GRCz11 13 9550909 - KASP Assay ID:
- 554-1284.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTACCTGGATGCCCTGTATCAGAACACAAACCCTCCGTCAGCACACACA[C/T]AATGTCCTCCTCGCCACTTTAAAGTGGGCACTATGAGCTCCTGCAGCCCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
