zgc:91802

Ensembl ID:
ENSDARG00000003206
ZFIN ID:
ZDB-GENE-040930-2
Description:
coiled-coil-helix-coiled-coil-helix domain-containing protein 6 [Source:RefSeq peptide;Acc:NP_00100
Human Orthologue:
CHCHD6
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 6 [Source:HGNC Symbol;Acc:28184]
Mouse Orthologue:
Chchd6
Mouse Description:
coiled-coil-helix-coiled-coil-helix domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913348]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17064 Nonsense Available for shipment Available now
sa44028 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39421 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014865 Nonsense 134 239 4 8
ENSDART00000123925 Nonsense 134 194 4 7
ENSDART00000143933 Nonsense 134 239 4 8

The following transcripts of ENSDARG00000003206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 34365102)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34127049
GRCz11 23 34053580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTGCAGAGAGAGCGAGCACAGAYGCGGCAGGAGTCTGAGAGAGCCAAA[C/T]AGCTGGTGAGTCTCTTCTGCAAACACTTYAGCAMAACACAGTACTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014865 Essential Splice Site 163 239 5 8
ENSDART00000123925 Essential Splice Site 171 194 6 7
ENSDART00000143933 Essential Splice Site 163 239 5 8

The following transcripts of ENSDARG00000003206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 34405434)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34167381
GRCz11 23 34093912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCGTTGGAGGCTTTTTACCAAGAACAAATCACACAGCTTGAGAAGAAG[G/A]TTAGTGATTTTTTTTTCATCCTTTATCAATTTCACAATATTTTTTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014865 Nonsense 223 239 7 8
ENSDART00000123925   None 194 None 7
ENSDART00000143933 Nonsense 223 239 7 8

The following transcripts of ENSDARG00000003206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 34448052)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34209999
GRCz11 23 34136530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAAACCGTGAGCAGACGCTTCAGTGCTCAGATCTGGCCAAAGAGTA[C/A]ATGCAGTGCATCAATGCAGCTAAGAAGGTAAGAAACAAGGAGATGCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link