
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:91802
- Ensembl ID:
- ENSDARG00000003206
- ZFIN ID:
- ZDB-GENE-040930-2
- Description:
- coiled-coil-helix-coiled-coil-helix domain-containing protein 6 [Source:RefSeq peptide;Acc:NP_00100
- Human Orthologue:
- CHCHD6
- Human Description:
- coiled-coil-helix-coiled-coil-helix domain containing 6 [Source:HGNC Symbol;Acc:28184]
- Mouse Orthologue:
- Chchd6
- Mouse Description:
- coiled-coil-helix-coiled-coil-helix domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913348]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17064 | Nonsense | Available for shipment | Available now |
sa44028 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa39421 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa17064
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014865 | Nonsense | 134 | 239 | 4 | 8 |
ENSDART00000123925 | Nonsense | 134 | 194 | 4 | 7 |
ENSDART00000143933 | Nonsense | 134 | 239 | 4 | 8 |
The following transcripts of ENSDARG00000003206 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 34365102)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 34127049 GRCz11 23 34053580 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGGTGCAGAGAGAGCGAGCACAGAYGCGGCAGGAGTCTGAGAGAGCCAAA[C/T]AGCTGGTGAGTCTCTTCTGCAAACACTTYAGCAMAACACAGTACTTCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44028
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014865 | Essential Splice Site | 163 | 239 | 5 | 8 |
ENSDART00000123925 | Essential Splice Site | 171 | 194 | 6 | 7 |
ENSDART00000143933 | Essential Splice Site | 163 | 239 | 5 | 8 |
The following transcripts of ENSDARG00000003206 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 34405434)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 34167381 GRCz11 23 34093912 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCGTTGGAGGCTTTTTACCAAGAACAAATCACACAGCTTGAGAAGAAG[G/A]TTAGTGATTTTTTTTTCATCCTTTATCAATTTCACAATATTTTTTTAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39421
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014865 | Nonsense | 223 | 239 | 7 | 8 |
ENSDART00000123925 | None | 194 | None | 7 | |
ENSDART00000143933 | Nonsense | 223 | 239 | 7 | 8 |
The following transcripts of ENSDARG00000003206 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 34448052)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 34209999 GRCz11 23 34136530 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGAAAACCGTGAGCAGACGCTTCAGTGCTCAGATCTGGCCAAAGAGTA[C/A]ATGCAGTGCATCAATGCAGCTAAGAAGGTAAGAAACAAGGAGATGCAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: