
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ngly1
- Ensembl ID:
- ENSDARG00000003205
- ZFIN ID:
- ZDB-GENE-050522-535
- Description:
- Peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase [Source:UniProtKB/Swiss-Prot;Acc:Q503I8]
- Human Orthologue:
- NGLY1
- Human Description:
- N-glycanase 1 [Source:HGNC Symbol;Acc:17646]
- Mouse Orthologue:
- Ngly1
- Mouse Description:
- N-glycanase 1 Gene [Source:MGI Symbol;Acc:MGI:1913276]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31033 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa6554 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23506 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31033
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019206 | Nonsense | 292 | 644 | 6 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 21251767)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 21185147 GRCz11 19 20769470 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCATTACGCAGGTACAATAACCCAGAGAAGCTTCTAGAGACCAGGAAA[G/T]GACGTTGTGGGGAATGGGCCAACTGTTTCACCCTGCTCTGCAGAGCCTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6554
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019206 | Nonsense | 360 | 644 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 21248972)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 21182352 GRCz11 19 20766675 - KASP Assay ID:
- 554-4620.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTGATAAACCCCTCCTGTATGAAGTTGGCTGGGGCAAGAAACTCTCCTA[C/A]ATCCTGGCCTTCTCCAAGGATCAGGTGGCAGATGTRACGTGGAGATACTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23506
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019206 | Nonsense | 575 | 644 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 21244438)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 21177818 GRCz11 19 20762141 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCCGAGCCTTCAGTCAGACCTTCCATTCAGGCACTGTGCGTTGGAGTT[T/G]AAGTACCAACGAGACCACCACAGAATTCCCTGGAGGTATGAGACTCACTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: