wdr21

Ensembl ID:
ENSDARG00000003197
ZFIN ID:
ZDB-GENE-040109-2
Description:
DDB1- and CUL4-associated factor 4 [Source:RefSeq peptide;Acc:NP_956995]
Human Orthologues:
DCAF4, DCAF4L1, DCAF4L2
Human Descriptions:
DDB1 and CUL4 associated factor 4 [Source:HGNC Symbol;Acc:20229]
DDB1 and CUL4 associated factor 4-like 1 [Source:HGNC Symbol;Acc:27723]
DDB1 and CUL4 associated factor 4-like 2 [Source:HGNC Symbol;Acc:26657]
Mouse Orthologue:
Dcaf4
Mouse Description:
DDB1 and CUL4 associated factor 4 Gene [Source:MGI Symbol;Acc:MGI:1921078]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36022 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024088 Essential Splice Site 111 318 3 9
Genomic Location (Zv9):
Chromosome 16 (position 4127765)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3285677
GRCz11 16 3186631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCTGTCGGTGGAGATGTGCGATAACCTTTATTTCACAAACCGCAAG[G/A]TGAGCTGTAGGTTTAAAATGAAACCTCTTCACACATACACAAAATATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link