stx5al

Ensembl ID:
ENSDARG00000003175
ZFIN ID:
ZDB-GENE-030131-1825
Description:
syntaxin 5A, like [Source:RefSeq peptide;Acc:NP_955924]
Human Orthologue:
STX5
Human Description:
syntaxin 5 [Source:HGNC Symbol;Acc:11440]
Mouse Orthologue:
Stx5a
Mouse Description:
syntaxin 5A Gene [Source:MGI Symbol;Acc:MGI:1928483]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13268 Essential Splice Site Available for shipment Available now
sa23950 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021121 Essential Splice Site 126 298 6 11
ENSDART00000146315 Essential Splice Site 175 347 7 12
Genomic Location (Zv9):
Chromosome 21 (position 25939211)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26509029
GRCz11 21 26545724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAGACATCTTCAGACACATTCCAACACCATCGTGGTCTCATTACAGG[T/C]ATTAACCTCTGGCTTTAGTATTCATTTAMAAAAYAGTGAWGTCTAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021121 Nonsense 198 298 9 11
ENSDART00000146315 Nonsense 247 347 10 12
Genomic Location (Zv9):
Chromosome 21 (position 25943231)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26513049
GRCz11 21 26549744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCAAGAAGACGGATATATCTATAGATATGGACCTGAATTCCAGTCAG[C/T]AGATGCAATTAGTCAATGAACGGGTATTGTTTGTTTATTGGTTGTTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link