si:dkey-27m7.4

Ensembl ID:
ENSDARG00000003146
ZFIN ID:
ZDB-GENE-090313-297
Description:
Novel protein similar to vertebrate neurofilament, medium polypeptide (NEFM) [Source:UniProtKB/TrEMB
Human Orthologues:
NES, SYNM
Human Descriptions:
nestin [Source:HGNC Symbol;Acc:7756]
synemin, intermediate filament protein [Source:HGNC Symbol;Acc:24466]
Mouse Orthologues:
Nes, Synm
Mouse Descriptions:
nestin Gene [Source:MGI Symbol;Acc:MGI:101784]
synemin, intermediate filament protein Gene [Source:MGI Symbol;Acc:MGI:2661187]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35449 Nonsense Available for shipment Available now
sa42169 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057913 Nonsense 303 1128 1 4
ENSDART00000145438 Nonsense 250 332 1 3
Genomic Location (Zv9):
Chromosome 13 (position 17752573)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17572608
GRCz11 13 17703600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGCGGAGATTAATGAACACAGGAGACAGCTCCAGTCCAAGAACATT[G/T]AGCTCGACTCCATGAAAGGGGTGAGAGAAGGACTGGAGAGGCAGCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057913 Nonsense 1126 1128 4 4
ENSDART00000145438   None 332 None 3
Genomic Location (Zv9):
Chromosome 13 (position 17759309)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17579344
GRCz11 13 17710336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTCAGATCAAGTCAAAGGGACCGAGAAGACAGACAGCGTAGACACC[A/T]AAGCTTCTTAAACCTTCTTATGTAGTATCGAATATAAATAGCAGAACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link