zgc:123105

Ensembl ID:
ENSDARG00000003127
ZFIN ID:
ZDB-GENE-051113-272
Description:
UPF0498 protein KIAA1191 homolog [Source:UniProtKB/Swiss-Prot;Acc:A4QNZ7]
Human Orthologue:
KIAA1191
Human Description:
KIAA1191 [Source:HGNC Symbol;Acc:29209]
Mouse Orthologue:
4833439L19Rik
Mouse Description:
RIKEN cDNA 4833439L19 gene Gene [Source:MGI Symbol;Acc:MGI:1921162]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9683 Essential Splice Site Available for shipment Available now
sa15363 Nonsense Available for shipment Available now
sa9723 Nonsense Available for shipment Available now
sa12126 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007675 Essential Splice Site None 317 2 9
ENSDART00000133099 Essential Splice Site None 310 2 9
ENSDART00000147318   None 239 None 5
Genomic Location (Zv9):
Chromosome 21 (position 31234258)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32433728
GRCz11 21 32466986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGATCAACCTGTGCTTTAGCAGTGGWGCGTCAGCTGCCATTCACTGG[T/C]AAGAGAGACATGTAATWATTTATGACACAAGATTTAATTTAAGGAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007675 Nonsense 247 317 8 9
ENSDART00000133099   None 310 None 9
ENSDART00000147318 Nonsense 169 239 4 5
ENSDART00000007675 Nonsense 247 317 8 9
ENSDART00000133099   None 310 None 9
ENSDART00000147318 Nonsense 169 239 4 5
Genomic Location (Zv9):
Chromosome 21 (position 31228041)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32427511
GRCz11 21 32460769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCAAGTCAGCAAGTCCACTACTGACCCAGGTACASATCCAGACACAT[C/A]AGGYAAAGCACATGATGCAGTTTACYCTTTAAAAACWACTTCTGCCTWTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007675 Nonsense 247 317 8 9
ENSDART00000133099   None 310 None 9
ENSDART00000147318 Nonsense 169 239 4 5
ENSDART00000007675 Nonsense 247 317 8 9
ENSDART00000133099   None 310 None 9
ENSDART00000147318 Nonsense 169 239 4 5
Genomic Location (Zv9):
Chromosome 21 (position 31228041)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32427511
GRCz11 21 32460769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCAAGTCAGCAAGTCCACTACTGACCCAGGTACASATCCAGACACAT[C/A]AGGYAAAGCACATGATGCAGTTTACCCTTTAAAAACWACTTCTGCCTWTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007675 Nonsense 316 317 9 9
ENSDART00000133099 Nonsense 309 310 9 9
ENSDART00000147318 Nonsense 238 239 5 5
Genomic Location (Zv9):
Chromosome 21 (position 31225924)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32425394
GRCz11 21 32458652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGTCCTCACAAACTCAAACACCGGGACATGAACGTCCTCACACCATCT[G/T]GATTCTGAAAGAATCCCTCCCTCCATCCATCCACCTCTGCTGYACTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link