zgc:100963

Ensembl ID:
ENSDARG00000003109
ZFIN ID:
ZDB-GENE-040801-135
Description:
calcipressin 1 [Source:RefSeq peptide;Acc:NP_001003616]
Human Orthologue:
RCAN1
Human Description:
regulator of calcineurin 1 [Source:HGNC Symbol;Acc:3040]
Mouse Orthologue:
Rcan1
Mouse Description:
regulator of calcineurin 1 Gene [Source:MGI Symbol;Acc:MGI:1890564]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020638 Nonsense 156 210 4 4
ENSDART00000134447 Nonsense 144 166 4 4

The following transcripts of ENSDARG00000003109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 36916430)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36054319
GRCz11 9 35863504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATKGCCTCCTTCTAAGAKTGAACTMTTTCTGTATGGCAGGKGAAAAATA[T/A]GAACTCCAACCAGGAACTCCGACCACTCCAAGTGTGGTTGTTCATGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link