zgc:101130

Ensembl ID:
ENSDARG00000003102
ZFIN ID:
ZDB-GENE-040801-72
Description:
Novel protein containing zinc finger C2H2 type domain [Source:UniProtKB/TrEMBL;Acc:Q1LXM0]
Human Orthologues:
ZNF501, ZNF502
Human Descriptions:
zinc finger protein 501 [Source:HGNC Symbol;Acc:23717]
zinc finger protein 502 [Source:HGNC Symbol;Acc:23718]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43750 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39356 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013201 Essential Splice Site 12 372 1 2
Genomic Location (Zv9):
Chromosome 22 (position 2591839)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1404687
GRCz11 22 1421585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCACTGAAGAGGATGGATCCATATGAAGATTTTGCAGAACAAAGAGG[T/C]TAGTGATTATTGATCATTCTTCGGTGGAATTAATCAAGTAGCCTAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013201 Nonsense 358 372 2 2
Genomic Location (Zv9):
Chromosome 22 (position 2594059)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1406907
GRCz11 22 1423805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGCTCGAAGAGTTTCAGGCGGGCGAGCCGTTTGTTGATTCATTTGAA[C/T]AAGCATCATTCGATGAATCTAACATTGTGGATTTTTCATGTTCATGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link