zgc:103506

Ensembl ID:
ENSDARG00000003084
ZFIN ID:
ZDB-GENE-041114-29
Description:
Protein spire homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3H9]
Human Orthologue:
SPIRE2
Human Description:
spire homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:30623]
Mouse Orthologue:
Spire2
Mouse Description:
spire homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2446256]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44347 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012287 Essential Splice Site 101 339 3 7
ENSDART00000035245 Essential Splice Site 101 730 2 15
ENSDART00000136226 Essential Splice Site 101 171 2 3
Genomic Location (Zv9):
Chromosome 25 (position 35960857)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34392189
GRCz11 25 34897147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCCAGATGACAGTAATGCTGGCTGTGAATCTGCTGCTGATGGAAAGG[T/C]GAGACTGTTATGGAACATTATATAATTGAAATGCTGGAAAGAGTACTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link