zgc:165344

Ensembl ID:
ENSDARG00000003081
ZFIN IDs:
ZDB-GENE-030131-9794, ZDB-GENE-030131-9794
Description:
myosin-binding protein H-like [Source:RefSeq peptide;Acc:NP_001093607]
Human Orthologues:
MYBPH, MYBPHL
Human Descriptions:
myosin binding protein H [Source:HGNC Symbol;Acc:7552]
myosin binding protein H-like [Source:HGNC Symbol;Acc:30434]
Mouse Orthologues:
Mybph, Mybphl
Mouse Descriptions:
myosin binding protein H Gene [Source:MGI Symbol;Acc:MGI:1858196]
myosin binding protein H-like Gene [Source:MGI Symbol;Acc:MGI:1916003]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33980 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa20826 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026359 Essential Splice Site 113 487 2 11
ENSDART00000122794 Missense 134 529 3 11
Genomic Location (Zv9):
Chromosome 6 (position 55011647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55028949
GRCz11 6 55038762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCAGCGAGCCCCTGGAGCTTGGCGTAGAGGACGTAAATGACACCTCC[G/A]TCACCATCTCATGGAGACCTCCAGCAACCATCGGAAACTCCGGCCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026359 Essential Splice Site 205 487 6 11
ENSDART00000122794 Essential Splice Site 247 529 6 11
Genomic Location (Zv9):
Chromosome 6 (position 55031262)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55047575
GRCz11 6 55057388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTAGAGATACTAATTCACAGCTTCTCTTGTATTGTTTTCTTACCGGC[A/T]GGGAAAACCCCAGCCTGTTGTGTCATGGACAAAGGATGGCCAGCCTATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link