sorbs2a

Ensembl ID:
ENSDARG00000003046
ZFIN ID:
ZDB-GENE-070308-2
Description:
Novel protein similar to vertebrate sorbin and SH3 domain containing 2 (SORBS2) [Source:UniProtKB/Tr
Human Orthologue:
SORBS2
Human Description:
sorbin and SH3 domain containing 2 [Source:HGNC Symbol;Acc:24098]
Mouse Orthologue:
Sorbs2
Mouse Description:
sorbin and SH3 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1924574]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1724 Nonsense Available for shipment Available now
sa32640 Nonsense Mutation detected in F1 DNA During 2018
sa39586 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39585 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215   None 1236 None 26
ENSDART00000138475 Nonsense 357 1258 10 21
Genomic Location (Zv9):
Chromosome 1 (position 16512406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17077574
GRCz11 1 17770511
KASP Assay ID:
554-1670.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTTGTTCTGGTGGCGGGACGTTCAGCCTCCTAAAAAGAGGTTGGATTA[T/A]AATCCTGACTACTCCACACATACTGTGGCACAGGTAAATCTGTCTTCCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 Nonsense 622 1236 14 26
ENSDART00000138475 Nonsense 654 1258 13 21
Genomic Location (Zv9):
Chromosome 1 (position 16504043)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17069211
GRCz11 1 17762148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGTCATGAGGTGCCACGGCAAATGGTTCCAAACCGTATATCTGCATA[T/G]GAACAGCTTATCCAAAAATCAAAGTCTATGCCAGATCTTGGCGATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 Essential Splice Site 1018 1236 17 26
ENSDART00000138475 Essential Splice Site 1052 1258 15 21
Genomic Location (Zv9):
Chromosome 1 (position 16501793)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17066961
GRCz11 1 17759898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGTCTGCCAGAGCAATTTATGATTTTAAAGCTCAGTCTGCCAA[G/T]TGAGTATACAGAAATGTGAAAGAAGCTCACTGGTGCATGCCAATAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 Essential Splice Site 1176 1236 None 26
ENSDART00000138475 Missense 1197 1258 19 21
Genomic Location (Zv9):
Chromosome 1 (position 16491614)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17056782
GRCz11 1 17749719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATATTATACAGTTTTTTTCTTTCTTTCAGAAAATGATGCAGGATTCTC[A/T]GCATGCAGGTGGTGACCCGTAAGTATTTTTTAGCACTTTAATTTTGACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link