hspa9

Ensembl ID:
ENSDARG00000003035
ZFIN ID:
ZDB-GENE-030828-12
Description:
stress-70 protein, mitochondrial [Source:RefSeq peptide;Acc:NP_958483]
Human Orthologue:
HSPA9
Human Description:
heat shock 70kDa protein 9 (mortalin) [Source:HGNC Symbol;Acc:5244]
Mouse Orthologue:
Hspa9
Mouse Description:
heat shock protein 9 Gene [Source:MGI Symbol;Acc:MGI:96245]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45508 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012438 Nonsense 622 682 16 17

The following transcripts of ENSDARG00000003035 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12422743)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11858516
GRCz11 14 12164530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTCTTTTGTAGTGTAACAAATTGAAGGAGGAGATCAGTAAAGTA[C/T]GAGAGCTTCTCTCGCGAAAGGATACCGAGACAGGAGAGAACATAAAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link