si:dkeyp-117h8.1

Ensembl ID:
ENSDARG00000002991
ZFIN ID:
ZDB-GENE-041210-325
Description:
Centrosomal protein of 135 kDa [Source:UniProtKB/Swiss-Prot;Acc:Q5RG45]
Human Orthologue:
CEP135
Human Description:
centrosomal protein 135kDa [Source:HGNC Symbol;Acc:29086]
Mouse Orthologue:
Cep135
Mouse Description:
centrosomal protein 135 Gene [Source:MGI Symbol;Acc:MGI:2681869]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23711 Essential Splice Site Available for shipment Available now
sa25136 Essential Splice Site Mutation detected in F1 DNA During 2018
sa616 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033436 Essential Splice Site 500 1164 11 25
ENSDART00000121585 Essential Splice Site 500 1170 10 25
ENSDART00000127359   None 427 None 12
Genomic Location (Zv9):
Chromosome 20 (position 25747759)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25819062
GRCz11 20 25718152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAGGCCGAGGGAGGAGCCCCAGAGGAAGAGGCAGCTGGCATGGAAAG[G/A]TGAAAGAGGCACTTATTTCTATAACTACTTGGGTGAGACATGGTTTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033436 Essential Splice Site 841 1164 20 25
ENSDART00000121585 Essential Splice Site 841 1170 19 25
ENSDART00000127359   None 427 None 12
Genomic Location (Zv9):
Chromosome 20 (position 25756229)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25827532
GRCz11 20 25726622
KASP Assay ID:
554-7387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCATATGATGTGCATCGCATATGCTCAGGTTCAGTGTGTCTTTCTCCA[G/A]GCAGTGCATGCAGAGATGCAGGAAGCTCTGAACGAGAGGGATGAACTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033436 Essential Splice Site 1077 1164 23 25
ENSDART00000121585 Essential Splice Site 1077 1170 22 25
ENSDART00000127359   None 427 None 12
Genomic Location (Zv9):
Chromosome 20 (position 25759544)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25830847
GRCz11 20 25729937
KASP Assay ID:
554-0526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAACTCAAAGTGCTGAAGGACCGCCTCGCCCTCGCTGACAGCAAAACG[T/G]AAGTGAGCTACTTTAGTTTTGATGAAACACTGCCCTTCATAGCGTAAGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link