zgc:193796

Ensembl ID:
ENSDARG00000002971
ZFIN ID:
ZDB-GENE-081022-39
Description:
polyhomeotic-like protein 1 [Source:RefSeq peptide;Acc:NP_991270]
Human Orthologues:
PHC1, PHC1B
Human Descriptions:
polyhomeotic homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3182]
polyhomeotic homolog 1B (Drosophila) [Source:HGNC Symbol;Acc:34502]
Mouse Orthologue:
Phc1
Mouse Description:
polyhomeotic-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:103248]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14378 Nonsense Available for shipment Available now
sa22883 Nonsense Available for shipment Available now
sa18402 Nonsense Available for shipment Available now
sa22884 Nonsense Available for shipment Available now
sa31005 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22885 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058496 Nonsense 54 901 3 15
ENSDART00000128810 Nonsense 54 828 3 15
ENSDART00000129536 Nonsense 54 897 3 16
Genomic Location (Zv9):
Chromosome 16 (position 34258055)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31989555
GRCz11 16 31943585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTATAGGCRCTGCAGGCCTTACAGAGGCAGCCCAATGCAGCTCAGTA[T/A]TTCCAGCAGCTGATGCTGCAGCAGCAGATCAACRGCGCAACCTGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058496 Nonsense 260 901 8 15
ENSDART00000128810 Nonsense 187 828 8 15
ENSDART00000129536 Nonsense 256 897 9 16
Genomic Location (Zv9):
Chromosome 16 (position 34265920)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31997420
GRCz11 16 31951450
KASP Assay ID:
2260-9915.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTACATTCCCACTTAACCAGCAGACTCAGACTCCACAACAGTTTGGT[C/T]AATCAACCCAGCAGGTCCAACCACAAACTCAACCCCTTGCCAACGCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058496 Nonsense 522 901 8 15
ENSDART00000128810 Nonsense 449 828 8 15
ENSDART00000129536 Nonsense 518 897 9 16
Genomic Location (Zv9):
Chromosome 16 (position 34266706)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31998206
GRCz11 16 31952236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTTAAAACAGCCCAAAGTGCCCTCCCTATCTCTCAGATGCAGACCAAT[C/T]AGAGTGCAGTATTGASTCAGGGTAATCCCGCTTCAGTCACACACKCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058496 Nonsense 577 901 9 15
ENSDART00000128810 Nonsense 504 828 9 15
ENSDART00000129536 Nonsense 573 897 10 16
Genomic Location (Zv9):
Chromosome 16 (position 34266952)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31998452
GRCz11 16 31952482
KASP Assay ID:
2260-9917.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGGTCCAATAAAAAGGAAGTCAGAGTCAGATTTGACCCATGAGATTT[C/A]GAATGAGCCAATCAGTGGAAGTCCCTCAATGCAAGACTCCGCCCCTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058496 Essential Splice Site 603 901 10 15
ENSDART00000128810 Essential Splice Site 530 828 10 15
ENSDART00000129536 Essential Splice Site 599 897 11 16
Genomic Location (Zv9):
Chromosome 16 (position 34269645)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32001145
GRCz11 16 31955175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTTTTGCTTTGTCTTCACCTTGCTTATTTTCTTTATTTCTCATTTA[G/A]TCCCAGAGATAGCATTCTCCTCTCCTCCTACATTGTCCCTCTCTCTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058496 Nonsense 724 901 13 15
ENSDART00000128810 Nonsense 651 828 13 15
ENSDART00000129536 Nonsense 720 897 14 16
Genomic Location (Zv9):
Chromosome 16 (position 34270735)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32002235
GRCz11 16 31956265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGAATCTTTTTTTTTTTTTAGGTACAATGTGAGCTTTAGAAACCACT[T/A]ACGGGCCAGTAGAGGTCTTGAGGGTGCAGAACGGCCAGCAGGGGGCCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link