ss18

Ensembl ID:
ENSDARG00000002970
ZFIN ID:
ZDB-GENE-030131-4867
Description:
protein SSXT [Source:RefSeq peptide;Acc:NP_956038]
Human Orthologue:
SS18
Human Description:
synovial sarcoma translocation, chromosome 18 [Source:HGNC Symbol;Acc:11340]
Mouse Orthologue:
Ss18
Mouse Description:
synovial sarcoma translocation, Chromosome 18 Gene [Source:MGI Symbol;Acc:MGI:107708]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39745 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011919 Nonsense 306 368 8 10
Genomic Location (Zv9):
Chromosome 2 (position 2371703)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2239355
GRCz11 2 1351773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCCCGCCTCAGCAGCAGGGTTACCCACCGCAGCAGCAGTACAGCGGG[C/T]AGCAGGGATACCCGGGACAGCAGCAGGGCTACGGTACGAACACACCGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link