
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
abcd3b
- Ensembl ID:
- ENSDARG00000002947
- ZFIN ID:
- ZDB-GENE-050517-29
- Description:
- ATP-binding cassette, sub-family D (ALD), member 3b [Source:RefSeq peptide;Acc:NP_001124092]
- Human Orthologue:
- ABCD3
- Human Description:
- ATP-binding cassette, sub-family D (ALD), member 3 [Source:HGNC Symbol;Acc:67]
- Mouse Orthologue:
- Abcd3
- Mouse Description:
- ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32865 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa19701 | Essential Splice Site | Available for shipment | Available now |
sa39791 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa32864 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32865
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005643 | Nonsense | 391 | 659 | 14 | 23 |
- Genomic Location (Zv9):
- Chromosome 2 (position 14937710)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 15448537 GRCz11 2 15117127 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTGTGTGTTTTATCTGGGATCTCCATCCATTTGTTAGGTTCACTGCA[C/T]GAATCACAGAAATACAAGAAGTCCTGAAGGAGCTGAATTCGGGAAAATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19701
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005643 | Essential Splice Site | 441 | 659 | 15 | 23 |
- Genomic Location (Zv9):
- Chromosome 2 (position 14936903)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 15447730 GRCz11 2 15116320 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCTTATCCCCGGGAGAGGTGAAATCATCATTGCAGACAATAAAATCAA[G/T]TAAATTACCAAGCAAACATCCACCAAGCCATCATAGTAACCTACTTAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39791
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005643 | Essential Splice Site | 488 | 659 | 17 | 23 |
- Genomic Location (Zv9):
- Chromosome 2 (position 14935173)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 15446000 GRCz11 2 15114590 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGCCCTAACGGATGTGGCAAGAGTTCCCTCTTCAGAGTCCTAGGAGAG[G/A]TTTGCACTAGAAATATGACTAGCTTTACAAACCATTGAGATTTGTTTTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32864
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005643 | Essential Splice Site | 580 | 659 | 20 | 23 |
- Genomic Location (Zv9):
- Chromosome 2 (position 14932514)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 15443341 GRCz11 2 15111931 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGGACTGGATGGACGTCCTCAGTGGAGGAGAGAAGCAGAGGATGGCTG[T/C]AAGATCAACTCTCCAAACCGGACACATTGCTGTCTTTTTGGTGGGTTTAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: