meis4.1a

Ensembl ID:
ENSDARG00000002937
ZFIN IDs:
ZDB-GENE-020122-3, ZDB-GENE-020122-4, ZDB-GENE-020122-4
Description:
myeloid ecotropic viral integration site 4.1a [Source:RefSeq peptide;Acc:NP_571972]
Human Orthologue:
MEIS1
Human Description:
Meis homeobox 1 [Source:HGNC Symbol;Acc:7000]
Mouse Orthologue:
Meis1
Mouse Description:
Meis homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:104717]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25673 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16771 Essential Splice Site Available for shipment Available now
sa45085 Nonsense Mutation detected in F1 DNA During 2018
sa44514 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028018 Essential Splice Site 4 380 None 13
ENSDART00000145313 Essential Splice Site 4 285 None 8

The following transcripts of ENSDARG00000002937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 51988334)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50835695
GRCz11 1 51479494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGTTGAGAAAAGCGAGTCGGTGACGCGGAGTCCTCATGGCGCAACGGG[T/A]GCGTAAAATCAACCAAAGGAGAGAAAAAAACTCAAACGTGGCCGTCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028018 Essential Splice Site 72 380 2 13
ENSDART00000145313 Essential Splice Site 72 285 2 8

The following transcripts of ENSDARG00000002937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 51989480)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50836841
GRCz11 1 51480640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCGCCCGTTAACGACGCGCTCAAGCGGGACAAAGACGCCATTTACGG[G/T]TATGTGCTGKGATTAAAATTATGTGYCATCACAAAGCTTGATTGCWGGRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028018 Nonsense 190 380 6 13
ENSDART00000145313 Nonsense 190 285 6 8

The following transcripts of ENSDARG00000002937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 51992336)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50839697
GRCz11 1 51483496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGATTTGGTGGTGGATGATAAAGAAGGGGGATCCAGATCCGACGGG[G/T]AGGAATTTACACGCACACCAGGAGGATCGGAGCAGGCAAGACTTCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028018 Essential Splice Site 285 380 None 13
ENSDART00000145313   285 285 None 8

The following transcripts of ENSDARG00000002937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 52005773)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50853134
GRCz11 1 51496933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGTGGCAACCAATATCATGAGAGCATGGCTGTTCCAGCACCTCACGG[T/C]AAAACACGTCTCTGCTTTCCCAATGATTACACTTTTAAGGTCTTAATTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link