
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-102c8.6
- Ensembl ID:
- ENSDARG00000002917
- ZFIN ID:
- ZDB-GENE-050208-408
- Description:
- hypothetical protein LOC556445 [Source:RefSeq peptide;Acc:NP_001077294]
- Human Orthologue:
- GLS2
- Human Description:
- glutaminase 2 (liver, mitochondrial) [Source:HGNC Symbol;Acc:29570]
- Mouse Orthologue:
- Gls2
- Mouse Description:
- glutaminase 2 (liver, mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:2143539]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32379 | Nonsense | Available for shipment | Available now |
sa39358 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa29725 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa30726 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32379
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031005 | Nonsense | 113 | 542 | 4 | 18 |
ENSDART00000147580 | Nonsense | 197 | 627 | 4 | 18 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10217271)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10077439 GRCz11 22 10107121 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCATTTGTGGACATCATCAATCACATTTATTACACATCAAAACTGCAA[C/T]AAGATGGACAGGTAAGATGTGTATTTTATTACCTCACTTTATGTACTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39358
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031005 | Essential Splice Site | 247 | 542 | 9 | 18 |
ENSDART00000147580 | Essential Splice Site | 332 | 627 | 9 | 18 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10214785)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10074953 GRCz11 22 10104635 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGTTAAGAAGATGACAGGCAGTGAGTACGTGGGCTTCAGCAACGCAAC[G/A]TATGTCTTATTAGTTTGATATTCTAAGCTTGTTTCCACCTGTTGACTCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29725
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031005 | Essential Splice Site | 441 | 542 | 15 | 18 |
ENSDART00000147580 | Essential Splice Site | 526 | 627 | 15 | 18 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10209694)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10069862 GRCz11 22 10099544 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAATCTGATGTTTGCGGCCCACAGTGGAGATGTTTCAGCTCTGAGGAGG[T/G]TACTTTATGCCACTCTCAACTTTTTCACTGTCAGTTTCTGACTGCTACCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30726
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031005 | Essential Splice Site | 488 | 542 | None | 18 |
ENSDART00000147580 | Essential Splice Site | 573 | 627 | None | 18 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10209123)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10069291 GRCz11 22 10098973 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCTTACCTTTAGCTAATCCATCAGATCTAAAACTAACCTCTGTCATTC[A/G]GGTGGGGAAATATTCCTCGAGACGATGCCATGCAGTTCGGGCAAAAGGAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Metabolic traits: Human metabolic individuality in biomedical and pharmaceutical research. (View Study)
- Metabolite levels: Genome-wide association study identifies multiple loci influencing human serum metabolite levels. (View Study)
- Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: