adipor1a

Ensembl ID:
ENSDARG00000002912
ZFIN ID:
ZDB-GENE-040718-169
Description:
adiponectin receptor 1a [Source:RefSeq peptide;Acc:NP_001002467]
Human Orthologue:
ADIPOR1
Human Description:
adiponectin receptor 1 [Source:HGNC Symbol;Acc:24040]
Mouse Orthologue:
Adipor1
Mouse Description:
adiponectin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1919924]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35080 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026258 Essential Splice Site 209 378 4 7
ENSDART00000082761   None 140 None 8
ENSDART00000125598   None 156 None 6
ENSDART00000131976 Essential Splice Site 206 375 6 9
Genomic Location (Zv9):
Chromosome 11 (position 25743388)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24572213
GRCz11 11 24809829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACACTGTCTACTGCCATTCTGAGAAAGTCTCACGCACTTTCTCCAAG[T/G]AAGTTTACTCTTTAGACCCTATTCACATTTCCAGGTTTCTCAGTAGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link