
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-287b5.1
- Ensembl ID:
- ENSDARG00000002880
- ZFIN ID:
- ZDB-GENE-060503-41
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LUH6]
- Human Orthologue:
- CCDC132
- Human Description:
- coiled-coil domain containing 132 [Source:HGNC Symbol;Acc:25956]
- Mouse Orthologue:
- Ccdc132
- Mouse Description:
- coiled-coil domain containing 132 Gene [Source:MGI Symbol;Acc:MGI:1920538]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10581 | Nonsense | Available for shipment | Available now |
sa32255 | Essential Splice Site | Available for shipment | Available now |
sa23579 | Nonsense | Available for shipment | Available now |
sa43334 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa29252 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa3030 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa10581
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017917 | Nonsense | 43 | 314 | 3 | 12 |
ENSDART00000110699 | Nonsense | 43 | 965 | 3 | 28 |
- Genomic Location (Zv9):
- Chromosome 19 (position 41356264)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 40808802 GRCz11 19 40395922 - KASP Assay ID:
- 2261-3613.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTCATTTYTTTTGCTTTTCACACAGGAGGAGCTGAGGGAGCTGAGAGAG[C/T]AGCCCAMSGATCCACAGGCAGAAMAAGAAATCATTGACAGCATAGAGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32255
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017917 | None | 314 | None | 12 | |
ENSDART00000110699 | Essential Splice Site | 544 | 965 | 18 | 28 |
- Genomic Location (Zv9):
- Chromosome 19 (position 41512606)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 40964961 GRCz11 19 40552081 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATAGACAACAAAGAAGAGGAGACTGAGGACGTCCTGGCTTCTAATGGGG[T/C]ATATAGTAGTTTGAATGATGGTCATGTTATGTACAGTTTTATATACTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23579
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017917 | None | 314 | None | 12 | |
ENSDART00000110699 | Nonsense | 646 | 965 | 21 | 28 |
- Genomic Location (Zv9):
- Chromosome 19 (position 41525869)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 40978224 GRCz11 19 40565344 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCCCATCGCCTTTGATGTCATCCACTGTGTGTCTCAGCTCTTTGATTA[T/G]TACCTGTATGCCGTCTACACCTTCTTCGGCCGCAATGACATGGTATGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43334
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017917 | None | 314 | None | 12 | |
ENSDART00000110699 | Essential Splice Site | 687 | 965 | 22 | 28 |
- Genomic Location (Zv9):
- Chromosome 19 (position 41548586)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 41000941 GRCz11 19 40588061 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGATTGAGGACCACTCTCAGCCGAATCCAGGAGAGCCTAATAGACATG[G/A]TGAGTAAAACATGACTCGTTTAATGCACTCTTTCAGTTTTCCCCCTGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29252
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017917 | None | 314 | None | 12 | |
ENSDART00000110699 | Nonsense | 776 | 965 | 25 | 28 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 41613297)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 41065551 GRCz11 19 40652671 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGACATTTTCCGCTGCTGTTTTCTCTACAGACTGTATCAACGGCCAGC[G/T]AGCTCCGCAAGCCCATTTACTGGATCGTGGCAGCCAAAGCCATAGATTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3030
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017917 | None | 314 | None | 12 | |
ENSDART00000110699 | Nonsense | 950 | 965 | 28 | 28 |
ENSDART00000017917 | None | 314 | None | 12 | |
ENSDART00000110699 | Nonsense | 950 | 965 | 28 | 28 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 41645988)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 41098242 GRCz11 19 40685362 - KASP Assay ID:
- 554-3435.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGACTAACCTGGTCAACGTCTGCCTCGGGTCCCACATCAACAAGAAAGCA[C/T]GACAGAAACTCCTCGCAGCCATTGATGACATTGACCGGCCCAAAAGATAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: