si:ch211-198b3.2

Ensembl ID:
ENSDARG00000002847
ZFIN ID:
ZDB-GENE-041210-332
Description:
Novel protein similar to vertebrate fibronectin type III domain containing 1 (FNDC1) [Source:UniProt
Human Orthologue:
FNDC1
Human Description:
fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:21184]
Mouse Orthologues:
CT485609.1, Fndc1
Mouse Description:
fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915905]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25140 Nonsense Mutation detected in F1 DNA During 2018
sa23734 Nonsense Available for shipment Available now
sa45706 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Nonsense 599 1645 11 22
ENSDART00000136039   None 110 None 4
ENSDART00000139643   None 335 None 8
Genomic Location (Zv9):
Chromosome 20 (position 31063827)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31135040
GRCz11 20 31037919
KASP Assay ID:
554-7520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAATCAAAACCCAGCAATTCTGACATTGTCCCTAAAACATCCGAGGAT[A/T]AACGTCCTCCTTGGACCCCTCGTACATCCTCAATTGTTGATATTAGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Nonsense 830 1645 11 22
ENSDART00000136039   None 110 None 4
ENSDART00000139643   None 335 None 8
Genomic Location (Zv9):
Chromosome 20 (position 31063134)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31134347
GRCz11 20 31037226
KASP Assay ID:
2261-4505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATTCCACTTCCCATTCTTCTTCAAGGACTAACCCTTCTACAACAGGA[C/T]GAAGTTCATCCTTTTCGTTACCAAACCGAAATTCTAGAATAGTTACAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Essential Splice Site 1361 1645 16 22
ENSDART00000136039 Essential Splice Site None 110 2 4
ENSDART00000139643 Essential Splice Site 51 335 2 8
Genomic Location (Zv9):
Chromosome 20 (position 31043810)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31115023
GRCz11 20 31017902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACATTCTGAAACTCTTTTTTTCCTCTTATCTTTCCCTTCTGTCCTCA[G/A]CTCCATATGTAAACTACATTCAGAAAGACCCTGGAGCTCCCTGCTCCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link