si:dkey-28b4.8

Ensembl ID:
ENSDARG00000002840
ZFIN ID:
ZDB-GENE-090501-2
Description:
Novel protein similar to H.sapiens ATP2A1, ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Human Orthologue:
ATP2A2
Human Description:
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 [Source:HGNC Symbol;Acc:812]
Mouse Orthologue:
Atp2a2
Mouse Description:
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39667 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45081 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046562 Essential Splice Site 367 1054 None 22
ENSDART00000133210   324 1012 8 20
Genomic Location (Zv9):
Chromosome 1 (position 45136701)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43979920
GRCz11 1 44681223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTATGCATGTGTGTGCATGTGTGTTTGTGTGCGTGCAGTTGTTTAT[T/C]GTAGACATGGTCGCAGGTGAGAGGTGTTTACTGAACGAGTTTACAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046562 Nonsense 1027 1054 22 22
ENSDART00000133210 Nonsense 985 1012 20 20
Genomic Location (Zv9):
Chromosome 1 (position 45109039)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43952258
GRCz11 1 44653561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGCTGGAGGGGTCGTCGGCAAACTGCAGAGTGCATTTAGAGGCATTT[C/A]GTGGTCGTTCGTCCTCATCTCCGCCCCGTTGCTGGTCTGGATCTTCAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link