zgc:77065

Ensembl ID:
ENSDARG00000002837
ZFIN ID:
ZDB-GENE-040426-2257
Description:
Beta-lactamase-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYF0]
Human Orthologue:
LACTB2
Human Description:
lactamase, beta 2 [Source:HGNC Symbol;Acc:18512]
Mouse Orthologue:
Lactb2
Mouse Description:
lactamase, beta 2 Gene [Source:MGI Symbol;Acc:MGI:2442551]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30406 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011776 Nonsense 14 95 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA544 (position 6639)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150307.1 6639
GRCz11 KN150307.1 6639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGGAGTGAAATGTCTGCGGTGATTCCTCGTATCGAGCAGCTGTCAGCG[C/T]GAGTGGTGCGGGTTTTGGGATGTAACCCGGGGCCAATGACACTGCAGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link