supt3h

Ensembl ID:
ENSDARG00000002776
ZFIN ID:
ZDB-GENE-040718-370
Description:
transcription initiation protein SPT3 homolog [Source:RefSeq peptide;Acc:NP_001002625]
Human Orthologue:
SUPT3H
Human Description:
suppressor of Ty 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:11466]
Mouse Orthologue:
Supt3h
Mouse Description:
suppressor of Ty 3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923723]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4690 Nonsense F2 line generated During 2018
sa2918 Essential Splice Site F2 line generated During 2018
sa5628 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa4690
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026904 Nonsense 12 297 1 10
ENSDART00000141251 Nonsense 49 162 3 6
ENSDART00000141598 Nonsense 72 185 4 7

The following transcripts of ENSDARG00000002776 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 4998427)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5099081
GRCz11 17 5256177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTTTCAGCTTCATCAAGCTGCAGAAGTGGCTCTCCTGAGA[G/T]GAGCTCGGGTCATTTCACCAGAGGAGATCATCTTCCTGATGAGGAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2918
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026904 Essential Splice Site 61 297 2 10
ENSDART00000141251 Essential Splice Site 98 162 4 6
ENSDART00000141598 Essential Splice Site 121 185 5 7
ENSDART00000026904 Essential Splice Site 61 297 None 10
ENSDART00000141251 Essential Splice Site 98 162 None 6
ENSDART00000141598 Essential Splice Site 121 185 None 7

The following transcripts of ENSDARG00000002776 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 4995127)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5095781
GRCz11 17 5252877
KASP Assay ID:
554-3144.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTAAAGTCCTGAAGACCATCGATGACGAAGACCTGCTGGATTCAGG[T/C]ATGACGTACGCTCCTTTTCCACATCTCTGATTTGTACAAGTCTGACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5628
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026904 Essential Splice Site 61 297 2 10
ENSDART00000141251 Essential Splice Site 98 162 4 6
ENSDART00000141598 Essential Splice Site 121 185 5 7
ENSDART00000026904 Essential Splice Site 61 297 None 10
ENSDART00000141251 Essential Splice Site 98 162 None 6
ENSDART00000141598 Essential Splice Site 121 185 None 7

The following transcripts of ENSDARG00000002776 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 4995127)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5095781
GRCz11 17 5252877
KASP Assay ID:
554-3144.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTAAAGTCCTGAAGACCATCGATGACGAAGACCTGCTGGATTCAGG[T/C]ATGACGTACGCTCCTTTTCCACATCTCTGATTTGTACAAGTCTGACTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link