si:ch211-48m9.1

Ensembl ID:
ENSDARG00000002771
ZFIN ID:
ZDB-GENE-060531-64
Description:
Novel protein similar to vertebrate solute carrier family 4, sodium bicarbonate cotransporter, membe
Human Orthologue:
SLC4A5
Human Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 5 [Source:HGNC Symbol;Acc:18168]
Mouse Orthologue:
Slc4a5
Mouse Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 5 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11294 Essential Splice Site Available for shipment Available now
sa1335 Essential Splice Site Available for shipment Available now
sa26483 Nonsense Mutation detected in F1 DNA During 2018
sa45206 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042002 Essential Splice Site 193 1134 4 25
ENSDART00000138140 Essential Splice Site 169 1017 3 21
Genomic Location (Zv9):
Chromosome 5 (position 29733938)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27489236
GRCz11 5 28089389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACCGTGCTGCTGGACCTGGAGGGATACTCGCTCCCACAGATYGTMGG[T/A]AAGCTTCTGRACATAAAACAGMAATTGTCTAGCATACTGAAGTGTGCATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042002 Essential Splice Site 779 1134 17 25
ENSDART00000138140 Essential Splice Site 740 1017 15 21
Genomic Location (Zv9):
Chromosome 5 (position 29710747)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27466045
GRCz11 5 28066198
KASP Assay ID:
554-1249.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTAATAGGTTTGAAAACACCCAAACTCATTGTGCCTACCGAGTTCAAG[G/A]TGAGAGTATAAATTAGGTTGATGTTGTGTGACTTTTTCAATGAAGTTCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa26483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042002 Nonsense 838 1134 19 25
ENSDART00000138140 Nonsense 799 1017 17 21
Genomic Location (Zv9):
Chromosome 5 (position 29709006)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27464304
GRCz11 5 28064457
KASP Assay ID:
2259-5883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTTTTTCAGTTTTTTTTTTTTTTGTTTTTACAGAAAGGCTGTGGGTA[T/A]CATCTGGATCTATTGTGGGTTGGCGTTCTGATGGCAGCCTGCTCTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042002 Nonsense 1121 1134 25 25
ENSDART00000138140   None 1017 None 21
Genomic Location (Zv9):
Chromosome 5 (position 29693165)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27448463
GRCz11 5 28048616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTGAGATGGAGTCGGACTATGAAGACACAGATATAAACCCTAGAGGC[A/T]GACACAGGGATCACAGGGACATGAGCAGCGAAACAACGCTGTAAAAACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link