
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gdf5
- Ensembl ID:
- ENSDARG00000002760
- ZFIN ID:
- ZDB-GENE-990415-39
- Description:
- Contact [Source:UniProtKB/TrEMBL;Acc:O42303]
- Human Orthologue:
- GDF5
- Human Description:
- growth differentiation factor 5 [Source:HGNC Symbol;Acc:4220]
- Mouse Orthologue:
- Gdf5
- Mouse Description:
- growth differentiation factor 5 Gene [Source:MGI Symbol;Acc:MGI:95688]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10139 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10139
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015051 | Nonsense | 222 | 474 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52591574)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52640579 GRCz11 6 52638908 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAATGGAGAAGGAGGGTCTGCTGGGTGCGGAGCTGCGGATCCTCCGAAAG[A/T]AGCACATGGACTCTCGAAAAGCCACKTTCTCTGAGGGCATGGCAGTTCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
- Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
- Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
- Height: Many sequence variants affecting diversity of adult human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: