wu:fj58c09

Ensembl ID:
ENSDARG00000002758
ZFIN ID:
ZDB-GENE-030131-8176
Description:
DNA-binding death effector domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_571677]
Human Orthologue:
DEDD2
Human Description:
death effector domain containing 2 [Source:HGNC Symbol;Acc:24450]
Mouse Orthologue:
Dedd2
Mouse Description:
death effector domain-containing DNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914629]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12434 Nonsense Available for shipment Available now
sa1017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065467 Nonsense 326 369 6 7
ENSDART00000104003 Nonsense 326 369 6 7
ENSDART00000128762   None 244 None 7
ENSDART00000139760 Nonsense 88 131 1 2

The following transcripts of ENSDARG00000002758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 12563684)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10968927
GRCz11 16 10859829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGGGGCGCTACTCGAGGCGCTGAAGGGGGTCTTCATTACGGACTCCT[T/A]GAAAAGGGCAGCAGGGCAGGAGGGTGTYCGGCYGCTGGTTAGTGTGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065467 Nonsense 346 369 6 7
ENSDART00000104003 Nonsense 346 369 6 7
ENSDART00000128762   None 244 None 7
ENSDART00000139760 Nonsense 108 131 1 2

The following transcripts of ENSDARG00000002758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 12563745)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10968988
GRCz11 16 10859890
KASP Assay ID:
554-0921.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGGCAGGAGGGTGTYCGGCTGCTGGTTAGTGTGGATCAGGATGACTA[T/A]GAGGAGGGCAGGAAACTGCTGATCAACAGCCAGACACAAAACTGGACAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link