zgc:56288

Ensembl ID:
ENSDARG00000002754
ZFIN ID:
ZDB-GENE-040426-967
Description:
programmed cell death protein 2-like [Source:RefSeq peptide;Acc:NP_956517]
Human Orthologue:
PDCD2L
Human Description:
programmed cell death 2-like [Source:HGNC Symbol;Acc:28194]
Mouse Orthologue:
Pdcd2l
Mouse Description:
programmed cell death 2-like Gene [Source:MGI Symbol;Acc:MGI:1915329]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25233 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003346 Nonsense 326 357 6 6
Genomic Location (Zv9):
Chromosome 25 (position 31444509)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 30011583
GRCz11 25 30454640
KASP Assay ID:
554-7408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTATTATTTTCAGAGATTTCACTGGAGTTTGGAACAGTTCTGGTGTA[T/A]ACTTGCAGAAACAGTTGTTGGAAATCTGGATCAACGGTTCCAGTGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link