
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sema6d
- Ensembl ID:
- ENSDARG00000002748
- ZFIN ID:
- ZDB-GENE-040426-1933
- Description:
- semaphorin-6C [Source:RefSeq peptide;Acc:NP_998164]
- Human Orthologue:
- SEMA6C
- Human Description:
- sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C [Source:HGNC Symbol;
- Mouse Orthologue:
- Sema6c
- Mouse Description:
- sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C Gene [Source:MGI Sym
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11733 | Essential Splice Site | Available for shipment | Available now |
sa3000 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa11733
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091031 | Essential Splice Site | 173 | 880 | 7 | 18 |
ENSDART00000136361 | Essential Splice Site | 191 | 898 | 7 | 18 |
- Genomic Location (Zv9):
- Chromosome 19 (position 419730)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 409661 GRCz11 19 409868 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCAAGATGTCCATTTGAGTCTCGACAGTCCAATGTWGGARTGTTTGCAG[G/A]TGAAACACACACASAGAYGGATGTGAARATATATACACCTGCAAAATAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3000
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091031 | Nonsense | 225 | 880 | 9 | 18 |
ENSDART00000136361 | Nonsense | 243 | 898 | 9 | 18 |
- Genomic Location (Zv9):
- Chromosome 19 (position 420848)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 410779 GRCz11 19 410986 - KASP Assay ID:
- 554-2467.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTGTTGTTTTGTTTCTGCAGAGCCTCATTTCCTGCACGCTGTCGAATA[C/A]GGGAACTATGTGTATTTCTTCTTCAGTGAGATYGCTGTGGAGCACACTGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: