spon2b

Ensembl ID:
ENSDARG00000002732
ZFIN ID:
ZDB-GENE-990415-161
Description:
spondin-2 [Source:RefSeq peptide;Acc:NP_571083]
Human Orthologue:
SPON2
Human Description:
spondin 2, extracellular matrix protein [Source:HGNC Symbol;Acc:11253]
Mouse Orthologue:
Spon2
Mouse Description:
spondin 2, extracellular matrix protein Gene [Source:MGI Symbol;Acc:MGI:1923724]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22444 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010148 Nonsense 114 331 2 5
ENSDART00000054588   None 92 4 7
ENSDART00000054590 Nonsense 114 331 3 6
Genomic Location (Zv9):
Chromosome 14 (position 15211146)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17073132
GRCz11 14 17378785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGAGAGCAGAGGCTTGGACCCTGATAAAGGAAGTGGAGGCAGCTGGG[G/T]AACGGATCCAGAGCGTCTATGGCCTCTTCTCAGCGCCAGCTGTGGTTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link