ankrd2

Ensembl ID:
ENSDARG00000002722
ZFIN ID:
ZDB-GENE-090313-383
Description:
Novel protein similar to H.sapiens ANKRD2, ankyrin repeat domain 2 (Stretch responsive muscle) (ANKR
Human Orthologue:
ANKRD2
Human Description:
ankyrin repeat domain 2 (stretch responsive muscle) [Source:HGNC Symbol;Acc:495]
Mouse Orthologue:
Ankrd2
Mouse Description:
ankyrin repeat domain 2 (stretch responsive muscle) Gene [Source:MGI Symbol;Acc:MGI:1861447]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42278 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074829 Nonsense 259 301 8 9
ENSDART00000134965 Nonsense 20 56 1 2
ENSDART00000146027   None 97 None 3
Genomic Location (Zv9):
Chromosome 13 (position 41349439)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40611491
GRCz11 13 40737381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGGTTCTACATGACGCTGTCAGATTTAATCGATATAAAATTGTCAAA[C/T]AGCTCATCCTGGCAGGAGCCGATATGCAGATCAAGAATGCTGTAAGTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link