
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
utp15
- Ensembl ID:
- ENSDARG00000002720
- ZFIN ID:
- ZDB-GENE-030131-3831
- Description:
- U3 small nucleolar RNA-associated protein 15 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW33]
- Human Orthologue:
- UTP15
- Human Description:
- UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25758]
- Mouse Orthologue:
- Utp15
- Mouse Description:
- UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2145443
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23221 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23221
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127397 | Nonsense | 467 | 517 | 13 | 13 |
- Genomic Location (Zv9):
- Chromosome 18 (position 6123649)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7078750 GRCz11 18 7037712 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGTTATTCCCCAGTCACCTGTGGTGGAGCGCCTGCTGCAGCGTCTTTA[T/A]GAGATTTTGGGTCGAGAAGCAGAACTTCAACAGGAGCTTCTGCAGGTTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: