utp15

Ensembl ID:
ENSDARG00000002720
ZFIN ID:
ZDB-GENE-030131-3831
Description:
U3 small nucleolar RNA-associated protein 15 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW33]
Human Orthologue:
UTP15
Human Description:
UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25758]
Mouse Orthologue:
Utp15
Mouse Description:
UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2145443

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23221 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127397 Nonsense 467 517 13 13
Genomic Location (Zv9):
Chromosome 18 (position 6123649)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7078750
GRCz11 18 7037712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTATTCCCCAGTCACCTGTGGTGGAGCGCCTGCTGCAGCGTCTTTA[T/A]GAGATTTTGGGTCGAGAAGCAGAACTTCAACAGGAGCTTCTGCAGGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link