zgc:63633

Ensembl ID:
ENSDARG00000002701
ZFIN IDs:
ZDB-GENE-040426-1201, ZDB-GENE-040426-1201
Description:
Ras-like protein family member 12 [Source:UniProtKB/Swiss-Prot;Acc:Q7SZ59]
Human Orthologue:
RASL12
Human Description:
RAS-like, family 12 [Source:HGNC Symbol;Acc:30289]
Mouse Orthologue:
Rasl12
Mouse Description:
RAS-like, family 12 Gene [Source:MGI Symbol;Acc:MGI:1918034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20872 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018801   None 255 None 6
ENSDART00000115054 Nonsense 203 255 6 6
Genomic Location (Zv9):
Chromosome 7 (position 14648083)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13529096
GRCz11 7 13781906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGCGAGAGACGGAGAGGAGCATCCGTCCACTCTTCATCAGCGAAGAC[A/T]AGTCTGCCATCAGCCTGAGCTCTGCTCCTCCACTCACCGCCTGCTATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link