zgc:103558

Ensembl ID:
ENSDARG00000002685
ZFIN ID:
ZDB-GENE-041212-23
Description:
hypothetical protein LOC494057 [Source:RefSeq peptide;Acc:NP_001008600]
Human Orthologues:
FAM113A, FAM113B
Human Descriptions:
family with sequence similarity 113, member A [Source:HGNC Symbol;Acc:16212]
family with sequence similarity 113, member B [Source:HGNC Symbol;Acc:28255]
Mouse Orthologues:
Fam113a, Fam113b
Mouse Descriptions:
family with sequence similarity 113, member A Gene [Source:MGI Symbol;Acc:MGI:2442177]
family with sequence similarity 113, member B Gene [Source:MGI Symbol;Acc:MGI:2446270]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2378 Nonsense F2 line generated During 2018
sa11694 Nonsense Available for shipment Available now
sa9030 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2378
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012483 Nonsense 72 415 4 10
ENSDART00000131530 Nonsense 72 295 4 8
ENSDART00000139455 Nonsense 72 196 3 5
Genomic Location (Zv9):
Chromosome 7 (position 26002935)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24564687
GRCz11 7 24835844
KASP Assay ID:
554-3205.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGGTGGAAGGAGGCAGACTGGGGGAGATGAATAATGGGACACAATAC[A/T]GAGAAGTTAGACAATACAGAACGGACCACCACTTGGTCCGCTTTTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012483 Nonsense 266 415 7 10
ENSDART00000131530 Nonsense 266 295 7 8
ENSDART00000139455   None 196 None 5
Genomic Location (Zv9):
Chromosome 7 (position 26001964)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24563716
GRCz11 7 24834873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTCATGCAGATCAGCAGGATTCTAAACCAGCAACCCAGCAGAACCGA[C/T]AAAGCGGGCTTTCAACTCCTCCTGTGCGCTATAGAGGTAYACTGTCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012483 Nonsense 266 415 7 10
ENSDART00000131530 Nonsense 266 295 7 8
ENSDART00000139455   None 196 None 5
Genomic Location (Zv9):
Chromosome 7 (position 26001964)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24563716
GRCz11 7 24834873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTCATGCAGATCAGCAGGATTCTAAACCAGCAACCCAGCAGAACCGA[C/T]AAAGCGGGCTTTCAACTCCTCCTGTGCGCTATAGAGGTAYACTGTCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link