zgc:73220

Ensembl ID:
ENSDARG00000002682
ZFIN ID:
ZDB-GENE-040426-1719
Description:
hypothetical protein LOC393726 [Source:RefSeq peptide;Acc:NP_957047]
Human Orthologue:
TBCEL
Human Description:
tubulin folding cofactor E-like [Source:HGNC Symbol;Acc:28115]
Mouse Orthologue:
Tbcel
Mouse Description:
tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22626 Nonsense Available for shipment Available now
sa15855 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006910   None 176 None 4
ENSDART00000124092 Nonsense 266 448 6 8
ENSDART00000135770 Nonsense 266 448 7 9
ENSDART00000138166 Nonsense 24 206 1 3

The following transcripts of ENSDARG00000002682 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 19909752)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21012378
GRCz11 15 20948110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGTTACCTTTTTTCTGATCATTTTATGTGAATCAGGACTTAATCGAT[G/A]GGAGGATATTGAGAAGCTAACCTTTCTGCCTAAGCTGGAAGAGGTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006910   None 176 None 4
ENSDART00000124092 Nonsense 430 448 8 8
ENSDART00000135770 Nonsense 430 448 9 9
ENSDART00000138166 Nonsense 188 206 3 3

The following transcripts of ENSDARG00000002682 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 19906469)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21009095
GRCz11 15 20944827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGGGCACTGCCTATGGCCCYGATGAGCTCAAATACAGTGCACGGGCCT[T/A]GCACTCCTACAGCATTCAAGATGGGGATGAGATCCTGGTAGTTCCAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link