zgc:113944

Ensembl ID:
ENSDARG00000002670
ZFIN IDs:
ZDB-GENE-040520-3, ZDB-GENE-050913-155, ZDB-GENE-050913-155
Description:
TATA box-binding protein-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q1JPY4]
Human Orthologue:
ATG14
Human Description:
ATG14 autophagy related 14 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:19962]
Mouse Orthologue:
Atg14
Mouse Description:
VATG14 autophagy related 14 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1261775]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23007 Nonsense Available for shipment Available now
sa23008 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018683 Nonsense 56 379 2 11
ENSDART00000051527   None 312 None 7
ENSDART00000097274 Nonsense 107 517 2 11
ENSDART00000127715 Nonsense 263 673 6 15
Genomic Location (Zv9):
Chromosome 17 (position 10611606)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10594695
GRCz11 17 10750729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATCATTTTGTCCTATTTTTGCTAACAGATATTCAGAAAAGCTTGAA[A/T]GACTCCAAAAGTTGAAAAATGAAAAGGAGGATCTTCAGCAGAGGTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018683 Nonsense 223 379 6 11
ENSDART00000051527   None 312 None 7
ENSDART00000097274 Nonsense 274 517 6 11
ENSDART00000127715 Nonsense 430 673 10 15
Genomic Location (Zv9):
Chromosome 17 (position 10616412)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10599501
GRCz11 17 10755535
KASP Assay ID:
2261-0691.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCACTGTCAGTGAGCTTGCAGAAGCCCGGAGAACCACCTATCACT[C/A]GGGCCGCTGGATCTGGGATGATCAGAACGGAGAGACGAGCATCAGCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link