
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:165474
- Ensembl ID:
- ENSDARG00000002666
- ZFIN ID:
- ZDB-GENE-070620-9
- Description:
- hypothetical protein LOC556608 [Source:RefSeq peptide;Acc:NP_001092204]
- Human Orthologue:
- KCNJ1
- Human Description:
- potassium inwardly-rectifying channel, subfamily J, member 1 [Source:HGNC Symbol;Acc:6255]
- Mouse Orthologue:
- Kcnj1
- Mouse Description:
- potassium inwardly-rectifying channel, subfamily J, member 1 Gene [Source:MGI Symbol;Acc:MGI:1927248
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14529 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14529
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019267 | Nonsense | 335 | 375 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 40671259)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 39385885 GRCz11 10 39307372 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCAATTTTTCCAAAACGCAGCAAGCAGATACTCCACATTGTGCTTGCTG[T/A]TTTCAYAACAAACATAAYAAGGGGCTCATTCTCCACCGGCATGGAAGCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: