stxbp5a

Ensembl ID:
ENSDARG00000002656
ZFIN ID:
ZDB-GENE-041001-161
Description:
syntaxin-binding protein 5 [Source:RefSeq peptide;Acc:NP_001093451]
Human Orthologue:
STXBP5
Human Description:
syntaxin binding protein 5 (tomosyn) [Source:HGNC Symbol;Acc:19665]
Mouse Orthologue:
Stxbp5
Mouse Description:
syntaxin binding protein 5 (tomosyn) Gene [Source:MGI Symbol;Acc:MGI:1926058]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39287 Nonsense Mutation detected in F1 DNA During 2018
sa23739 Nonsense Available for shipment Available now
sa1213 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa39287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101760 Nonsense 153 748 5 22
ENSDART00000101762 Nonsense 153 1129 5 27
ENSDART00000133788   None 177 None 5
ENSDART00000139417   None 217 None 6
ENSDART00000142806 Nonsense 153 1128 5 27
Genomic Location (Zv9):
Chromosome 20 (position 31863190)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31921430
GRCz11 20 31824309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCTTCAGGATAACGTTCTGTCATCTGCCCTTCCAAAGCAAATGGT[T/A]GTACATCGGCTCGGAACGAGGAAACATCCACATCGTGAATGTGGAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101760 Nonsense 159 748 5 22
ENSDART00000101762 Nonsense 159 1129 5 27
ENSDART00000133788   None 177 None 5
ENSDART00000139417   None 217 None 6
ENSDART00000142806 Nonsense 159 1128 5 27
Genomic Location (Zv9):
Chromosome 20 (position 31863173)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31921413
GRCz11 20 31824292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCTGTCATCTGCCCTTCCAAAGCAAATGGTTGTACATCGGCTCGGAA[C/T]GAGGAAACATCCACATCGTGAATGTGGAGTCCTTTACCCTCTCAGGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1213
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101760 Nonsense 505 748 15 22
ENSDART00000101762 Nonsense 505 1129 15 27
ENSDART00000133788   None 177 None 5
ENSDART00000139417 Nonsense 57 217 3 6
ENSDART00000142806 Nonsense 505 1128 15 27
Genomic Location (Zv9):
Chromosome 20 (position 31816120)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31874360
GRCz11 20 31777239
KASP Assay ID:
554-1122.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCACAGAGATTGTGGATGAAGACCCATTCGCCATTCAGTTGATGTCTT[G/A]GTGTCCCGAGAGCCGAATGCTTTGTGTGGCTGGTGTCTCTGCCCACRTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coagulation factor levels: Novel associations of multiple genetic loci with plasma levels of factor VII, factor VIII, and von Willebrand factor: The CHARGE (Cohorts for Heart and Aging Research in Genome Epidemiology) Consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link