zgc:85722

Ensembl ID:
ENSDARG00000002635
ZFIN ID:
ZDB-GENE-040516-7
Description:
hypothetical protein LOC407982 [Source:RefSeq peptide;Acc:NP_999978]
Human Orthologue:
FAM184A
Human Description:
family with sequence similarity 184, member A [Source:HGNC Symbol;Acc:20991]
Mouse Orthologue:
Fam184a
Mouse Description:
family with sequence similarity 184, member A Gene [Source:MGI Symbol;Acc:MGI:1923156]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6464 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36362 Nonsense Mutation detected in F1 DNA During 2018
sa6463 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005313 Essential Splice Site 305 1011 2 17
ENSDART00000030587 Essential Splice Site 305 1011 2 17
ENSDART00000131684   None 353 None 8
Genomic Location (Zv9):
Chromosome 17 (position 15215286)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15366114
GRCz11 17 15374047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCAACCGGCTGCAGGCCTCGCTCAATAATGCTGAAGTCACAATTAAG[G/A]TAATRAGTTTATAGCTTTTGATYAGGGATRGAGATTCAMTGAAGGCCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005313 Nonsense 665 1011 10 17
ENSDART00000030587 Nonsense 665 1011 10 17
ENSDART00000131684 Nonsense 7 353 1 8
Genomic Location (Zv9):
Chromosome 17 (position 15177968)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15328796
GRCz11 17 15336729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAATGAAATGACTTGTGTCTGTGTGTTGTCAGATCTCGCTGCTGAAA[C/T]AGAGCCTGGAGCTGCAGATGTCGCAGTCGAAGAGCGCGCTGCAGCAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005313 Nonsense 837 1011 13 17
ENSDART00000030587 Nonsense 837 1011 13 17
ENSDART00000131684 Nonsense 179 353 4 8
Genomic Location (Zv9):
Chromosome 17 (position 15166373)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15317201
GRCz11 17 15325134
KASP Assay ID:
554-4908.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCCGTGCGCAGGAGCAGGACCTTTTGGGTCGTATCTCTGACCTGAGG[C/T]AGGAGGTGAGCTGCAGGAAGAACCGCATCGCTGATCTGGACCATGAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link