
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
asap1
- Ensembl ID:
- ENSDARG00000002607
- Human Orthologues:
- ASAP1, ASAP2, ASAP3
- Human Descriptions:
- ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:2720]
- ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:2721]
- ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:14987]
- Mouse Orthologues:
- 6530401G17Rik, Asap1, Asap3
- Mouse Descriptions:
- ArfGAP with SH# domain, ankyrin repeat and PH domain1 Gene [Source:MGI Symbol;Acc:MGI:1342335]
- ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2684986]
- RIKEN cDNA 6530401G17 gene Gene [Source:MGI Symbol;Acc:MGI:1923478]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6210 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa6211 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38846 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa7350 | Missense | Mutation detected in F1 DNA | During 2018 |
sa21921 | Essential Splice Site | Available for shipment | Available now |
sa1614 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6210
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103507 | Essential Splice Site | 254 | 1018 | 8 | 28 |
- Genomic Location (Zv9):
- Chromosome 11 (position 27442752)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 26271578 GRCz11 11 26509194 - KASP Assay ID:
- 554-5111.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGAAGCTGAAGCAGTACATTGATGCCCTCRCAGGACAGCTGAGCGCAG[T/C]GAGTGATTCTTGCATGCCAAYGATTGTACAAATGTATTCTGTGAATCGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6211
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103507 | Nonsense | 303 | 1018 | 10 | 28 |
- Genomic Location (Zv9):
- Chromosome 11 (position 27454476)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 26283302 GRCz11 11 26520918 - KASP Assay ID:
- 554-5112.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCAGACAGACYGTATACAGCAWGCATCAGCTTCAAGGCAACAAGCAATA[T/A]GGTACAGAGAAATCCGGCTACCTCTACAAGAGGAGTGATGGGTAAATGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38846
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103507 | Nonsense | 356 | 1018 | 12 | 28 |
- Genomic Location (Zv9):
- Chromosome 11 (position 27457366)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 26286192 GRCz11 11 26523808 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCAGCCCAATAAATCACCAGCTAAACTCAACCTACTCACCTGCCAAGTC[A/T]AGCCCAGTCTAGAAGACAAGAAATGCTTTGACCTCATCTCACGTGAGTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7350
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103507 | Missense | 454 | 1018 | 15 | 28 |
- Genomic Location (Zv9):
- Chromosome 11 (position 27465945)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 26294771 GRCz11 11 26532387 - KASP Assay ID:
- 554-4115.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTTTCTTTCAGATCCGAGTTGGATCTCTATAAACCTGGGAATCCTGACA[T/A]GCATTGAGTGCTCAGGGATCCATCGGGAGATGGGTGTACATTATTCACGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21921
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103507 | Essential Splice Site | 516 | 1018 | 17 | 28 |
- Genomic Location (Zv9):
- Chromosome 11 (position 27469010)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 26297836 GRCz11 11 26535452 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAGGACTCAATAAAACAGAGAGTGTACTTAAATATGTGGTGTTATTCGC[A/C]GGGCTGTACGCAAGGACTTTATACTCTCGAAATACATGGAGTGGCAGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1614
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103507 | Nonsense | 534 | 1018 | 17 | 28 |
- Genomic Location (Zv9):
- Chromosome 11 (position 27469064)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 26297890 GRCz11 11 26535506 - KASP Assay ID:
- 554-1555.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTACGCAAGGACTTTATACTCTCGAAATACATGGAGTGGCAGTTTGCA[C/T]AGCGCAGCGGCGGCTCACTGGAAACAAAGCGCAAATATCTGCAGGACGCT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Multiple sclerosis: Genome-wide association study identifies new multiple sclerosis susceptibility loci on chromosomes 12 and 20. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: